WormMine: Gene WBGene00037984

• WormBase Gene ID: WBGene00037984
• Gene Name: Cbr-acs-2
• Sequence Name: CBG18597
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-htz-1 based on RNA-seq studies. Is predicted to encode a protein with the following domains: AMP-dependent synthetase/ligase; AMP-binding enzyme; AMP-binding enzyme, C-terminal domain; AMP-binding enzyme C-terminal domain; and ANL, N-terminal domain. Is an ortholog of C. elegans acs-2. In C. elegans, acs-2 is involved in fatty acid metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18597.1	CBG18597.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18597	CBG18597		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated
Virus infection: Santeuil infected at L3 larva stage for 12 hours.	Transcripts that showed signicantly decreased expression after Santeuil virus infection to C. briggsae strain JU1264.	edgeR, FDR < 0.05.	WBPaper00051137:Santeuil-virus_downregulated_JU1264

1 Expression Patterns

• Primary Identifier: Expr1061326
• Remark: Cbr-acs-2, AATCTCCAAAGAGCTATTGGGATTGGGAACTGTCAAGTCGCATTTCACAGAAGTCGTTGA, WBGene00037984
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term