WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00027184 Gene Name  CBG04539
Sequence Name  ? CBG04539 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domain: Abnormal cell migration protein 18-like. Is an ortholog of C. elegans ZC412.3. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG04539b.1 CBG04539b.1   [unknown]
Transcript:CBG04539a.1 CBG04539a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG04539a CBG04539a   [unknown]
CDS:CBG04539b CBG04539b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG04538, TCAATCAGAACTTGACTTCTAATGGTCTTCTCTACATGTGCATCCACCAAAACGATCAGT, WBGene00027183   Expr1059049 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG04539, ATCTACAGTTGCGCTAAGGACGGAGCCAACTACAGCTTCAAAACCTACAGCCTCAAGGCA, WBGene00027184   Expr1065157 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term