WormMine: Gene WBGene00058011

• WormBase Gene ID: WBGene00058011
• Gene Name: CRE18574
• Sequence Name: CRE18574
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Cytochrome b561/ferric reductase transmembrane and Eukaryotic cytochrome b561. Is an ortholog of C. elegans F39G3.5. In C. elegans, F39G3.5 is involved in innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE18574.1	CRE18574.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE18574	CRE18574		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1093885
• Remark: CRE18574, TACAATAACTTCACAAGTGTTCACAGTTGGATTGGCGTTTGCCTTATCGCCGTTTATCTT, WBGene00058011
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term