WormMine: Gene WBGene00134938

• WormBase Gene ID: WBGene00134938
• Gene Name: Cjp-szy-20
• Sequence Name: CJA15734
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: SUZ domain and SUZ domain-containing protein 1. Is an ortholog of C. elegans szy-20. In C. elegans, szy-20 is involved in several processes, including negative regulation of protein localization to centrosome; positive regulation of fertilization; and regulation of cell cycle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15734c.1	CJA15734c.1		[unknown]
Transcript:CJA15734a.1	CJA15734a.1		[unknown]
Transcript:CJA15734b.1	CJA15734b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15734a	CJA15734a		[unknown]
CDS:CJA15734b	CJA15734b		[unknown]
CDS:CJA15734c	CJA15734c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081540
• Remark: Cjp-pqn-14, CGGAATGGAGGTCAGCAGAGGCAGATTGCGCCGAATCAGCGGAAGAATATGAATAGTGGC, WBGene00134938
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term