WormMine: Gene WBGene00123557

• WormBase Gene ID: WBGene00123557
• Gene Name: Cjp-igdb-3
• Sequence Name: CJA04353
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Fibronectin type III; Domain of unknown function DB; Immunoglobulin-like fold; Fibronectin type III domain; DB module; Immunoglobulin-like domain superfamily; and Fibronectin type III superfamily. Is an ortholog of C. elegans igdb-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA04353b.1	CJA04353b.1		[unknown]
Transcript:CJA04353c.1	CJA04353c.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA04353c	CJA04353c		[unknown]
CDS:CJA04353b	CJA04353b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072309
• Remark: CJA04353, GCTGAGATTGGAAAGCTCTTCAAATGTACTGCCAGTGAATTGAACAGTTCTGGATGCTGC, WBGene00123557
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term