WormMine: Gene WBGene00136330

• WormBase Gene ID: WBGene00136330
• Gene Name: Cjp-tmem-17
• Sequence Name: CJA17125
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Uncharacterised protein family, transmembrane-17 and Predicted membrane protein. Is an ortholog of C. elegans tmem-17.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17125b.1	CJA17125b.1		[unknown]
Transcript:CJA17125a.1	CJA17125a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17125b	CJA17125b		[unknown]
CDS:CJA17125a	CJA17125a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079020
• Remark: CJA17125, AGCGTTGAAAAAGACGGCGGATCGTGAAGTTTCGAAATACTTGGACAAGATTGAGCGGGA, WBGene00136330
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term