WormMine: Gene WBGene00028568

• WormBase Gene ID: WBGene00028568
• Gene Name: Cbr-vps-8
• Sequence Name: CBG06265
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Anaphase-promoting complex subunit 4, WD40 domain; WD40/YVTN repeat-like-containing domain superfamily; Anaphase-promoting complex subunit 4 WD40 domain; Golgi CORVET complex core vacuolar protein 8; Vacuolar protein sorting-associated protein 8, central domain; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans vps-8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06265.1	CBG06265.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06265	CBG06265		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059518
• Remark: CBG06265, CACTAATATTGAAAAAGTTTGCACATGCAACGGTTTCTCCAATCCACTAGTCGTACCTCG, WBGene00028568
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term