WormMine: Gene WBGene00033103

• WormBase Gene ID: WBGene00033103
• Gene Name: Cbr-nab-1
• Sequence Name: CBG12099
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Neurabin-1/2, PDZ domain; Neurabin-like family; Sterile alpha motif domain; PDZ domain; Sterile alpha motif/pointed domain superfamily; SAM domain (Sterile alpha motif); and PDZ superfamily. Is an ortholog of C. elegans nab-1. In C. elegans, nab-1 is involved in synapse assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12099a.1	CBG12099a.1		[unknown]
Transcript:CBG12099b.1	CBG12099b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12099b	CBG12099b		[unknown]
CDS:CBG12099a	CBG12099a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057825
• Remark: Cbr-nab-1, ACGAAGGACTCGCTTACAAACCAGGCGGTGAACTTCCTCACGAAGATAAAGCAGTAATGG, WBGene00033103
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term