WormMine: Gene WBGene00072351

• WormBase Gene ID: WBGene00072351
• Gene Name: CRE14248
• Sequence Name: CRE14248
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: RGS, subdomain 1/3; RGS domain; Regulator of G protein signaling domain; and RGS domain superfamily. Is an ortholog of C. elegans rgs-1 and rgs-2. In C. elegans, rgs-1 is involved in chemosensory behavior and sensory perception of bitter taste.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE14248.1	CRE14248.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE14248	CRE14248		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1097947
• Remark: CRE14248, TGTCAATCTTCCCCCCTTCTCATACTTCCCCCAAAATTGGCGCCAAAATTCAAATATCAT, WBGene00072351
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term