WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00126326 Gene Name  Cjp-ubxn-3
Sequence Name  ? CJA07122 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Ubiquitin-like domain superfamily; UAS; UBX domain; and Thioredoxin-like superfamily. Is an ortholog of C. elegans ubxn-3. In C. elegans, ubxn-3 is involved in several processes, including developmental process involved in reproduction; positive regulation of mitotic cell cycle, embryonic; and regulation of protein localization to chromatin. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA07122.1 CJA07122.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA07122 CJA07122   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-ubxn-3, CAACTCGGACTTTCCGAAAAAGGAAATCACCGGCGCGTTTGATTTGTCGAAGAAGTTTTC, WBGene00126326   Expr1078801 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term