WormMine: Gene WBGene00028594

• WormBase Gene ID: WBGene00028594
• Gene Name: CBG06295
• Sequence Name: CBG06295
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: MATH domain; BTB/POZ domain; MATH/TRAF domain; SKP1/BTB/POZ domain superfamily; and TRAF-like.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06295.1	CBG06295.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06295	CBG06295		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069507
• Remark: CBG06295, AAAAATATGTGTAGTCGAGTGTTTTTTAAAGAGTTCTCCGATCCCTTGGATATGGTGGTT, WBGene00028594
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term