WormMine: Gene WBGene00059331

• WormBase Gene ID: WBGene00059331
• Gene Name: Cre-hcf-1
• Sequence Name: CRE10832
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Kelch-type beta propeller; Galactose oxidase/kelch, beta-propeller; Fibronectin type III; Immunoglobulin-like fold; Host cell factor 1; Kelch motif; Kelch repeat type 1; Galactose oxidase, central domain; and Fibronectin type III superfamily. Is an ortholog of C. elegans hcf-1. In C. elegans, hcf-1 is involved in several processes, including dauer exit; determination of adult lifespan; and regulation of DNA-templated transcription.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE10832.1	CRE10832.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE10832	CRE10832		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1109414
• Remark: Cre-hcf-1, TGGCAGTGAAGAGTCAAACGGCAAATCCTGCTGATAGTCAGTTGGCATTCATGAGAGTGT, WBGene00059331
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term