WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00064625 Gene Name  Cre-fcho-1
Sequence Name  ? CRE17946 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Fes/CIP4, and EFC/F-BAR homology domain; FCH domain; Muniscin C-terminal mu homology domain; Muniscin C-terminal; and AH/BAR domain superfamily. Is an ortholog of C. elegans fcho-1. In C. elegans, fcho-1 is involved in clathrin-dependent endocytosis. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE17946.1 CRE17946.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE17946 CRE17946   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE17946, GAGGTGTCTCTCGTGCAATCGGATATTTATCATTTGTCGATGATTCGCAAGAAATTACTA, WBGene00064625   Expr1109699 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term