WormMine: Gene WBGene00037749

• WormBase Gene ID: WBGene00037749
• Gene Name: CBG18302
• Sequence Name: CBG18302
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Somatomedin B domain; Somatomedin-B and thrombospondin type-1 domain-containing protein; Thrombospondin type-1 (TSP1) repeat superfamily; Thrombospondin type-1 (TSP1) repeat; and Somatomedin B-like domain superfamily. Is an ortholog of C. elegans sbsp-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18302b.1	CBG18302b.1		[unknown]
Transcript:CBG18302a.1	CBG18302a.1		[unknown]
Transcript:CBG18302d.1	CBG18302d.1		[unknown]
Transcript:CBG18302c.1	CBG18302c.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18302d	CBG18302d		[unknown]
CDS:CBG18302b	CBG18302b		[unknown]
CDS:CBG18302c	CBG18302c		[unknown]
CDS:CBG18302a	CBG18302a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057200
• Remark: CBG18302, GAATCAATCGAACCGACAATTGCCAGTGCCAAGTACAGTATCCCCAGAATCACCCATTTC, WBGene00037749
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term