WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00025845 Gene Name  CBG02876
Sequence Name  ? CBG02876 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Major sperm protein (MSP) domain; Immunoglobulin-like fold; MSP (Major sperm protein) domain; and PapD-like superfamily. Is an ortholog of C. elegans ZK546.3; Y59E9AR.1; and F58A6.9. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG02876.1 CBG02876.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG02876 CBG02876   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG02876, CAAACCCAACCAAACGCCAAGATCGTCTTCAATGCTCCATACGACGACAAGCACACCTAC, WBGene00025845   Expr1055961 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term