WormMine: Gene WBGene00129115

• WormBase Gene ID: WBGene00129115
• Gene Name: Cjp-unc-41
• Sequence Name: CJA09911
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Mu homology domain; Adaptor complexes medium subunit family; and AP-2 complex subunit mu, C-terminal superfamily. Is an ortholog of C. elegans unc-41. In C. elegans, unc-41 is involved in positive regulation of locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09911a.1	CJA09911a.1		[unknown]
Transcript:CJA09911b.1	CJA09911b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09911b	CJA09911b		[unknown]
CDS:CJA09911a	CJA09911a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1073286
• Remark: CJA09911, CGATTGTCAATAAGCCAGAGTTTGATAAGGAGCAAGTGATTTCGTTCAGCCCACCAGATG, WBGene00129115
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term