WormMine: Gene WBGene00070759

• WormBase Gene ID: WBGene00070759
• Gene Name: Cre-ubql-1
• Sequence Name: CRE14291
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Ubiquitin family; Ubiquitin-associated domain; UBA/TS-N domain; Ubiquitin-like domain superfamily; Heat shock chaperonin-binding; Ubiquitin-like domain; and UBA-like superfamily. Is an ortholog of C. elegans ubql-1. In C. elegans, ubql-1 is involved in ERAD pathway; negative regulation of double-strand break repair via homologous recombination; and protein export from nucleus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE14291.1	CRE14291.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE14291	CRE14291		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1110106
• Remark: CRE14291, TCAGGCGAGCATGTTCAGTCCAGAAGTCATCGATTCTATTCGTCAGAATATGTCTAGCAA, WBGene00070759
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term