WormMine: Gene WBGene00079127

• WormBase Gene ID: WBGene00079127
• Gene Name: CRE06224
• Sequence Name: CRE06224
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: N-terminal domain of unknown function (DUF4140); Domain of unknown function DUF4140; Conserved hypothetical protein CHP02231; Domain of unknown function (DUF4139); and Domain of unknown function DUF4139. Is an ortholog of C. elegans F37C4.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE06224.1	CRE06224.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE06224	CRE06224		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:membranous_oraganelle_CRE

1 Expression Patterns

• Primary Identifier: Expr1110338
• Remark: CRE06224, CAAGACTGCTTCAGCCACAGTGAAATCGAGTAACATTGCATCTGAATTCAGCATCGGACG, WBGene00079127
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term