WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00133143 Gene Name  Cjp-par-3
Sequence Name  ? CJA13939 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: PDZ domain; PDZ superfamily; Par3/HAL, N-terminal; and N-terminal of Par3 and HAL proteins. Is an ortholog of C. elegans par-3. In C. elegans, par-3 is involved in several processes, including establishment of mitotic spindle orientation; gonad development; and polarity specification of anterior/posterior axis. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA13939.1 CJA13939.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA13939 CJA13939   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-par-3, GTGTACATTACGCCACGAAGGAGAAGTATGCGGATGCTCGAGCTGGAAAACAGTTTAACG, WBGene00133143   Expr1075278 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA07685, GCAGTTTTCCGTCGTCGCCTCAGCCACTGGATACGTGAATTCGTCAATGTCGACACTCGA, WBGene00126889   Expr1088338 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term