2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00004879 | smg-1 | C48B6.6 | Caenorhabditis elegans |
| WBGene00006789 | unc-54 | F11C3.3 | Caenorhabditis elegans |
| WormBase ID | WBStrain00030606 | CGC Received | 1997-04-23 |
| Genotype | smg-1(cc545) unc-54(r293) I. | Laboratory | CGC |
| Name | PD8117 | Remark | Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).] |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00004879 | smg-1 | C48B6.6 | Caenorhabditis elegans |
| WBGene00006789 | unc-54 | F11C3.3 | Caenorhabditis elegans |
