WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00030607 CGC Received  1997-04-23
Genotype  smg-1(cc546) unc-54(r293) I. Laboratory  CGC
Name  PD8118 Remark  Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
Species  Caenorhabditis elegans

2 Alleles

Public Name
r293
cc546

1 Data Sets

Name URL
WormBaseAcedbConverter  

2 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00004879 smg-1 C48B6.6 Caenorhabditis elegans
WBGene00006789 unc-54 F11C3.3 Caenorhabditis elegans