WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00053186 Gene Name  Cre-magu-2.2
Sequence Name  ? CRE05601 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Guanylate kinase/L-type calcium channel beta subunit; PDZ domain; Variant SH3 domain; SH3 domain; PDZ superfamily; P-loop containing nucleoside triphosphate hydrolase; SH3-like domain superfamily; and Guanylate kinase. Is an ortholog of C. elegans magu-2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE05601.1 CRE05601.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE05601 CRE05601   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-tag-117, CACATCATTTTCATCGCCGCCCCATCTCTTCATATACTCAGACGACAAAGAGAAGTTGAA, WBGene00053186   Expr1115661 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term