WormMine: Gene WBGene00053186

• WormBase Gene ID: WBGene00053186
• Gene Name: Cre-magu-2.2
• Sequence Name: CRE05601
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Guanylate kinase/L-type calcium channel beta subunit; PDZ domain; Variant SH3 domain; SH3 domain; PDZ superfamily; P-loop containing nucleoside triphosphate hydrolase; SH3-like domain superfamily; and Guanylate kinase. Is an ortholog of C. elegans magu-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE05601.1	CRE05601.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE05601	CRE05601		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1115661
• Remark: Cre-tag-117, CACATCATTTTCATCGCCGCCCCATCTCTTCATATACTCAGACGACAAAGAGAAGTTGAA, WBGene00053186
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term