WormMine: Gene WBGene00121591

• WormBase Gene ID: WBGene00121591
• Gene Name: CJA02387
• Sequence Name: CJA02387
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: 7TM GPCR, serpentine receptor class r (Str) and Serpentine type 7TM GPCR chemoreceptor Str. Is an ortholog of C. elegans str-143 and str-144.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02387c.1	CJA02387c.1		[unknown]
Transcript:CJA02387a.1	CJA02387a.1		[unknown]
Transcript:CJA02387b.1	CJA02387b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02387a	CJA02387a		[unknown]
CDS:CJA02387c	CJA02387c		[unknown]
CDS:CJA02387b	CJA02387b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084260
• Remark: CJA02387, CGCTTTGGAACCTCTCATTGCTATATTGTTTATACGAGATTTTAGAAGGACAGTTTTATG, WBGene00121591
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term