WormMine: Gene WBGene00052848

• WormBase Gene ID: WBGene00052848
• Gene Name: Cre-lpin-1
• Sequence Name: CRE05620
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: LNS2/PITP; lipin, N-terminal conserved region; HAD-like superfamily; LNS2 (Lipin/Ned1/Smp2); Lipin, N-terminal; and Lipin/Ned1/Smp2 (LNS2). Is an ortholog of C. elegans lpin-1. In C. elegans, lpin-1 is involved in several processes, including endomembrane system organization; macromolecule localization; and nematode larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE05620.1	CRE05620.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE05620	CRE05620		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1110139
• Remark: CRE05620, CAAGTGGAAAAGTGAAACGATCGGACTCGTCGGGACTCGCACTCAGCTATAAATCAATGG, WBGene00052848
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term