WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00119842 Gene Name  CJA00638
Sequence Name  ? CJA00638 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: OST3 / OST6 family, transporter family; Oligosaccharyl transferase complex, subunit OST3/OST6; and Thioredoxin-like superfamily. Is an ortholog of C. elegans ZK686.3. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA00638a.1 CJA00638a.1   [unknown]
Transcript:CJA00638b.1 CJA00638b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA00638a CJA00638a   [unknown]
CDS:CJA00638b CJA00638b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA00638, CACTAACCCGAACACCAAAGAGCCATCTTTCATCCATGGATCCACACAATTCCAATTGAT, WBGene00119842   Expr1070870 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term