WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00119784 Gene Name  Cjp-ger-1
Sequence Name  ? CJA00579 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: NAD dependent epimerase/dehydratase family; NAD(P)-binding domain superfamily; and NAD-dependent epimerase/dehydratase. Is an ortholog of C. elegans ger-1. In C. elegans, ger-1 is involved in GDP-L-fucose biosynthetic process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA00579a.1 CJA00579a.1   [unknown]
Transcript:CJA00579c.1 CJA00579c.1   [unknown]
Transcript:CJA00579b.1 CJA00579b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA00579c CJA00579c   [unknown]
CDS:CJA00579a CJA00579a   [unknown]
CDS:CJA00579b CJA00579b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-ger-1, TTCTGCTGTCGTAAAGGCGATCGGATTCGAAGGATCCGTCGAATACGACACCTCCAAAGC, WBGene00119784   Expr1085624 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term