WormMine: Gene WBGene00119654

• WormBase Gene ID: WBGene00119654
• Gene Name: CJA00450
• Sequence Name: CJA00450
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: BRCT domain; Ankyrin repeat; Domain of unknown function WSN; BRCT domain superfamily; Domain of unknown function; Ankyrin repeat-containing domain superfamily; and BRCA1 C Terminus (BRCT) domain. Is an ortholog of C. elegans C18H2.5; F37A4.4; and lido-18.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00450a.1	CJA00450a.1		[unknown]
Transcript:CJA00450b.1	CJA00450b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00450b	CJA00450b		[unknown]
CDS:CJA00450a	CJA00450a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079174
• Remark: CJA00450, AATGAAAGGTATCTGGTCGAAACTCCCGTTAAACTTCAACTCCACAGACGTCAATCGTCT, WBGene00119654
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term