WormMine: Gene WBGene00119668

• WormBase Gene ID: WBGene00119668
• Gene Name: Cjp-ced-1
• Sequence Name: CJA00464
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Laminin-type EGF domain; Laminin EGF domain; and EGF-like domain. Is an ortholog of C. elegans ced-1. In C. elegans, ced-1 is involved in several processes, including cytoskeleton organization; phagocytosis; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00464a.1	CJA00464a.1		[unknown]
Transcript:CJA00464b.1	CJA00464b.1		[unknown]
Transcript:CJA00464c.1	CJA00464c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00464a	CJA00464a		[unknown]
CDS:CJA00464c	CJA00464c		[unknown]
CDS:CJA00464b	CJA00464b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076430
• Remark: Cjp-ced-1, GAACATTTGGCTTGAAATGCGTCAACGAATGCCCGGCTGAATGCGGCGACGGATACGAGT, WBGene00119668
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term