| WormBase ID | WBStrain00033361 | CGC Received | 2019-03-05 |
| Genotype | nas-17(ve535[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Laboratory | CGC |
| Made By | WBPerson14989 | Mutagen | CRISPR_Cas9 |
| Name | RG3035 | Remark | Superficially wild-type. CRISPR/Cas9 deletion of nas-17. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: AATCACTTCGACATGTTTCTTCGACCATCT Right flanking sequence: TACGGAAGCAGCAAGTTGACAATTCATTAC |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00003514 | myo-2 | T18D3.4 | Caenorhabditis elegans |
| WBGene00003536 | nas-17 | K03B8.2 | Caenorhabditis elegans |
| WBGene00004496 | rps-27 | F56E10.4 | Caenorhabditis elegans |
| WBGene00006789 | unc-54 | F11C3.3 | Caenorhabditis elegans |
