1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000481 | cha-1 | ZC416.8 | Caenorhabditis elegans |
| WormBase ID | WBStrain00033375 | CGC Received | 2019-05-13 |
| Genotype | cha-1(md39) IV. | Laboratory | CGC |
| Made By | WBPerson508 | Mutagen | EMS |
| Name | RM777 | Outcrossed | x6 |
| Remark | Temperature-sensitive lethal. Maintain at 15C. At 16-20C: aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. At 25C: tight coils, virtually no movement, virtually no pumping, no growth, no long-term survival. The animals rapidly respond to temperature shift in either direction, even after more than an hour at the non-permissive temperature. Amino acid change: A499D Sequence data: AGAAAGCTGGAATTATTTAAGAAGG / C>A / TGTGCTCAAGCAGGTCAAGGTCACG (in direction of transcription). Reference: Rand JB. Genetics. 1989 May;122(1):73-80. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000481 | cha-1 | ZC416.8 | Caenorhabditis elegans |
