1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00006756 | unc-17 | ZC416.8 | Caenorhabditis elegans |
| WormBase ID | WBStrain00033373 | CGC Received | 2019-05-13 |
| Genotype | unc-17(cn355) IV. | Laboratory | CGC |
| Made By | WBPerson508 | Name | RM523 |
| Outcrossed | x>3 | Remark | cn355 behaves like other unc-17 hypomorphs (coily Unc, slow growth, aldicarb-resistant, etc.); however, the mutation is in the splice site necessary for generating unc-17 transcripts, so that unc-17 transcripts and UNC-17 protein are dramatically reduced (hence the unc-17 behavioral phenotypes), and the cha-1 transcripts, CHA-1 protein, and ChAT enzyme activity are significantly increased (Mathews et al., 2015). Note: UNC-17 and CHA-1 protein sequences are both completely wild-type; the phenotypes derive from the extremely low level of the (wild-type) UNC-17 protein. Flanking Sequences: AAATTTAGAAAAAATAAAATATTCC/ A>G /GGGGGAGAGAGAGAGATGGGCTTCA (in direction of transcription). Reference: Mathews EA, et al. Genetics. 2015 Mar;199(3):729-37. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00006756 | unc-17 | ZC416.8 | Caenorhabditis elegans |
