WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00033350 CGC Received  2018-12-09
Genotype  sra-30(ve523[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Laboratory  CGC
Made By  WBPerson14989 Mutagen  CRISPR_Cas9
Name  RG3023 Remark  Superficially wild-type. CRISPR/Cas9 deletion of sra-30. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ctgaaacagtaaattattaactaacCTGAA Right flanking sequence: TGAATTCATTGCCTCGAGAATTCCAGAAGA
Species  Caenorhabditis elegans

1 Alleles

Public Name
ve523

1 Data Sets

Name URL
WormBaseAcedbConverter  

4 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003514 myo-2 T18D3.4 Caenorhabditis elegans
WBGene00004496 rps-27 F56E10.4 Caenorhabditis elegans
WBGene00005056 sra-30 Y40H7A.6 Caenorhabditis elegans
WBGene00006789 unc-54 F11C3.3 Caenorhabditis elegans