WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00033375 CGC Received  2019-05-13
Genotype  cha-1(md39) IV. Laboratory  CGC
Made By  WBPerson508 Mutagen  EMS
Name  RM777 Outcrossed  x6
Remark  Temperature-sensitive lethal. Maintain at 15C. At 16-20C: aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. At 25C: tight coils, virtually no movement, virtually no pumping, no growth, no long-term survival. The animals rapidly respond to temperature shift in either direction, even after more than an hour at the non-permissive temperature. Amino acid change: A499D Sequence data: AGAAAGCTGGAATTATTTAAGAAGG / C>A / TGTGCTCAAGCAGGTCAAGGTCACG (in direction of transcription). Reference: Rand JB. Genetics. 1989 May;122(1):73-80. Species  Caenorhabditis elegans

1 Alleles

Public Name
md39

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000481 cha-1 ZC416.8 Caenorhabditis elegans