WormMine: Gene WBGene00051217

• WormBase Gene ID: WBGene00051217
• Gene Name: Cre-xol-1.1
• Sequence Name: CRE00480
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Switch protein XOL-1, N-terminal; Ribosomal protein S5 domain 2-type fold, subgroup; Switch protein XOL-1, GHMP-like; GHMP kinase, C-terminal domain superfamily; and Ribosomal protein S5 domain 2-type fold. Is an ortholog of C. elegans xol-1. In C. elegans, xol-1 is involved in dosage compensation by hypoactivation of X chromosome; intergenic mRNA trans splicing; and male sex determination.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00480.1	CRE00480.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00480	CRE00480		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1111851
• Remark: CRE00480, ACAACTTTAGAGTCTTCAAAGGCTTTGAAATTCAGCAAGGAGGAATACTGTTGGCTCTGA, WBGene00051217
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term