WormMine: Gene WBGene00051267

• WormBase Gene ID: WBGene00051267
• Gene Name: Cre-ref-2
• Sequence Name: CRE00505
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans ref-2. In C. elegans, ref-2 is involved in several processes, including neuron fate specification; positive regulation of transcription by RNA polymerase II; and regulation of cell division.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00505.1	CRE00505.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00505	CRE00505		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1098856
• Remark: Cre-ref-2, CCAGAATCAGTTTGTCAATCCCCACTACCCAATGTTTGTTCCAAAAGTACTTGAGTACTA, WBGene00051267
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term