WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00076181 Gene Name  CRE20175
Sequence Name  ? CRE20175 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: WD repeat-containing protein WDR46/Utp7; BING4, C-terminal domain; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; BING4CT (NUC141) domain; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans wdr-46. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE20175.1 CRE20175.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE20175 CRE20175   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE20175, TGTCCGTTCAGTACACACCACGTCATAAGATGCGAAGCAAGAAAAGTGGCTGGAAGATGG, WBGene00076181   Expr1103541 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term