WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00054889 Gene Name  Cre-cosa-1
Sequence Name  ? CRE25479 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Cyclin N-terminal domain-containing protein 1 and Cyclin-like superfamily. Is an ortholog of C. elegans cosa-1. In C. elegans, cosa-1 is involved in reciprocal meiotic recombination. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE25479.1 CRE25479.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE25479 CRE25479   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE25479, TGGTCTGCCCTACACAATAACTGCTGTTTCCGATTCTGAACAACGAGTTTTCAAACTAAT, WBGene00054889   Expr1107925 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term