1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00002368 | let-99 | K08E7.3 | Caenorhabditis elegans |
| WormBase ID | WBStrain00034721 | CGC Received | 2006-12-20 |
| Genotype | let-99(dd17) IV/nT1 [qIs51] (IV;V). | Laboratory | CGC |
| Made By | WBPerson3268 | Mutagen | EMS |
| Name | TH112 | Outcrossed | x5 |
| Remark | let-99(dd17) contains a 647bp deletion with the flanking sequences aatttttaggaagtttccagaaatttttcc / CAAGGCTCCCACGAAGATTATCGCGATCTA. The deletion removes the N terminus of the open reading frame including the start codon and the DEP domain. Heterozygotes are GFP+ in the pharynx. dd17 is a maternal effect lethal mutation. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00002368 | let-99 | K08E7.3 | Caenorhabditis elegans |
