WormMine: Gene WBGene00054263

• WormBase Gene ID: WBGene00054263
• Gene Name: CRE26450
• Sequence Name: CRE26450
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Ribosomal protein L10; 60S ribosomal protein L10P, insertion domain; Ribosomal protein L10P; and Insertion domain in 60S ribosomal protein L10P. Is an ortholog of C. elegans F10E7.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE26450.1	CRE26450.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE26450	CRE26450		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1106794
• Remark: CRE26450, TGTGCAAGGAAGGAGAGCCATTGACTGTTGAGCAAGCCAAAATCTTGAAACATTTCGAGA, WBGene00054263
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term