WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00054277 Gene Name  Cre-mfsd-13.2
Sequence Name  ? CRE26174 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: MFS/sugar transport protein; Transmembrane protein 180; and MFS transporter superfamily. Is an ortholog of C. elegans mfsd-13.2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE26174.1 CRE26174.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE26174 CRE26174   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE26174, TTAAAAGCTCTTTTCAACAAACCAGCCGACCAACTTGCTCCAGTTCTCATTCTTTCTCTC, WBGene00054277   Expr1116498 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term