WormMine: Gene WBGene00054236

• WormBase Gene ID: WBGene00054236
• Gene Name: Cre-lst-6
• Sequence Name: CRE26188
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: dDENN domain; PLAT/LH2 domain superfamily; PLAT/LH2 domain; uDENN domain; cDENN domain; RUN domain; RUN domain superfamily; and DENN (AEX-3) domain. Is an ortholog of C. elegans lst-6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE26188.1	CRE26188.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE26188	CRE26188		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101196
• Remark: CRE26188, ATGCTCGTGGATAAAATGGGAAAGGAAGCAGTGAATTGTGGTCACCTGGATCCAACTTTC, WBGene00054236
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term