1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00004750 | sea-1 | F19B10.9 | Caenorhabditis elegans |
| WormBase ID | WBStrain00035145 | CGC Received | 2007-04-11 |
| Genotype | sea-1(y356) II. | Laboratory | CGC |
| Made By | WBPerson495 | Mutagen | EMS |
| Name | TY3579 | Outcrossed | x>8 |
| Remark | Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00004750 | sea-1 | F19B10.9 | Caenorhabditis elegans |
