WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00035145 CGC Received  2007-04-11
Genotype  sea-1(y356) II. Laboratory  CGC
Made By  WBPerson495 Mutagen  EMS
Name  TY3579 Outcrossed  x>8
Remark  Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains. Species  Caenorhabditis elegans

1 Alleles

Public Name
y356

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00004750 sea-1 F19B10.9 Caenorhabditis elegans