WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00053469 Gene Name  Cre-mix-1.2
Sequence Name  ? CRE02183 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; RecF/RecN/SMC N terminal domain; and RecF/RecN/SMC, N-terminal. Is an ortholog of C. elegans mix-1. In C. elegans, mix-1 is involved in several processes, including dosage compensation by hypoactivation of X chromosome; mitotic chromosome condensation; and positive regulation of nematode male tail tip morphogenesis. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE02183.1 CRE02183.1   [unknown]
Transcript:CRE02183.2 CRE02183.2   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE02183 CRE02183   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE02183, CGAGGAATCGGTCTCAACGTTAATAACCCACACTTTCTTATCATGCAAGGACGCATTACA, WBGene00053469   Expr1096009 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term