WormMine: Gene WBGene00053520

• WormBase Gene ID: WBGene00053520
• Gene Name: Cre-bigr-1
• Sequence Name: CRE02160
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Haloacid dehalogenase-like hydrolase; Phosphoglycolate phosphatase-like, domain 2; HAD hydrolase, subfamily IA; HAD superfamily; HAD-like superfamily; and Predicted HAD-superfamily phosphatase, subfamily IA/Epoxide hydrolase, N-terminal. Is an ortholog of C. elegans bigr-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE02160.1	CRE02160.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE02160	CRE02160		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1110184
• Remark: CRE02160, ATGATCTTCATGAGAATATCGAAGCTGCCGAGAAGCTGGGATGGAATACAATTATGGTCA, WBGene00053520
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term