WormMine: Gene WBGene00025602

• WormBase Gene ID: WBGene00025602
• Gene Name: Cbr-rgs-3
• Sequence Name: CBG02574
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: RGS domain; Regulator of G protein signaling domain; and RGS domain superfamily. Is an ortholog of C. elegans rgs-3. In C. elegans, rgs-3 is involved in chemosensory behavior and sensory perception of bitter taste.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02574b.1	CBG02574b.1		[unknown]
Transcript:CBG02574a.1	CBG02574a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02574b	CBG02574b		[unknown]
CDS:CBG02574a	CBG02574a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053529
• Remark: Cbr-rgs-3, GAACGTCGCATCCAGGACAACAACATCGATATCACTCTCTTCGATGAGGCCATCAAACAC, WBGene00025602
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term