1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00008429 | etc-1 | D2085.4 | Caenorhabditis elegans |
WormBase ID | WBStrain00037910 | CGC Received | 2019-03-15 |
Genotype | etc-1(gk5182) II. | Laboratory | CGC |
Mutagen | EMS | Name | VC4092 |
Outcrossed | x0 | Remark | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5182 mutation is C->T, flanking sequences TCGTTCTTTCAGGAGACTATCAAAATGGCT and AGCTACTTGTCAATTTCTATGAAACGAATA. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00008429 | etc-1 | D2085.4 | Caenorhabditis elegans |