WormMine: Strain WBStrain00037912

• WormBase ID: WBStrain00037912
• CGC Received: 2019-03-15
• Genotype: col-141(gk5185) V.
• Laboratory: CGC
• Mutagen: EMS
• Name: VC4094
• Outcrossed: x0
• Remark: Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5185 mutation is T->G, flanking sequences GATGATCTTCAACGACATCAACTCATTCTA and GATGAAAAGATTGAGGAGCTCAATGAGTTC.
• Species: Caenorhabditis elegans

1 Alleles

Public Name
gk5185

1 Data Sets

• WormBaseAcedbConverter

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00000714	col-141	T15B7.5	Caenorhabditis elegans