3 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00011260 | cnnm-5 | R13G10.4 | Caenorhabditis elegans |
WBGene00013865 | ZC334.7 | ZC334.7 | Caenorhabditis elegans |
WBGene00021471 | Y39G10AR.15 | Y39G10AR.15 | Caenorhabditis elegans |
WormBase ID | WBStrain00037928 | CGC Received | 2019-03-15 |
Genotype | Y39G10AR.15(gk5206) ZC334.7(gk5207) I; cnnm-5(gk5208) III. | Laboratory | CGC |
Mutagen | EMS | Name | VC4126 |
Outcrossed | x0 | Remark | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5206 mutation is T->A, flanking sequences GGCCTTTCCAACTTAGAATTTTGGTCGTCC and GAAAAATAACGAAGTTATGGTGAACTCCCT. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00011260 | cnnm-5 | R13G10.4 | Caenorhabditis elegans |
WBGene00013865 | ZC334.7 | ZC334.7 | Caenorhabditis elegans |
WBGene00021471 | Y39G10AR.15 | Y39G10AR.15 | Caenorhabditis elegans |