1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00007820 | clec-199 | C30H6.1 | Caenorhabditis elegans |
WormBase ID | WBStrain00037921 | CGC Received | 2019-03-15 |
Genotype | clec-199(gk5198) IV. | Laboratory | CGC |
Mutagen | EMS | Name | VC4119 |
Outcrossed | x0 | Remark | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5198 mutation is G->A, flanking sequences AATTAAAAAATGTTTAATACCACCTATTCA and ACAGCAAAAACTACAAAGTCCACGACAACC. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00007820 | clec-199 | C30H6.1 | Caenorhabditis elegans |